Overview

Distribution

Indo-West Pacific: Persian Gulf, southern Oman, India, Indonesia, northwestern Australia and the South China Sea. Reported from Japan (Ref. 12484). Southwest Atlantic: Brazil (Ref. 12484).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific and southwestern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 14; Analspines: 0; Analsoft rays: 12 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

26.0 cm TL (male/unsexed; (Ref. 11441))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin moderately emarginate.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 1.1 - 237
  Temperature range (°C): 18.800 - 28.395
  Nitrate (umol/L): 0.954 - 8.099
  Salinity (PPS): 34.202 - 37.794
  Oxygen (ml/l): 3.800 - 5.263
  Phosphate (umol/l): 0.177 - 0.678
  Silicate (umol/l): 2.202 - 6.661

Graphical representation

Depth range (m): 1.1 - 237

Temperature range (°C): 18.800 - 28.395

Nitrate (umol/L): 0.954 - 8.099

Salinity (PPS): 34.202 - 37.794

Oxygen (ml/l): 3.800 - 5.263

Phosphate (umol/l): 0.177 - 0.678

Silicate (umol/l): 2.202 - 6.661
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 1.1 - 237
  Temperature range (°C): 18.800 - 28.395
  Nitrate (umol/L): 0.954 - 8.099
  Salinity (PPS): 34.202 - 37.794
  Oxygen (ml/l): 3.800 - 5.263
  Phosphate (umol/l): 0.177 - 0.678
  Silicate (umol/l): 2.202 - 6.661

Graphical representation

Depth range (m): 1.1 - 237

Temperature range (°C): 18.800 - 28.395

Nitrate (umol/L): 0.954 - 8.099

Salinity (PPS): 34.202 - 37.794

Oxygen (ml/l): 3.800 - 5.263

Phosphate (umol/l): 0.177 - 0.678

Silicate (umol/l): 2.202 - 6.661
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lagocephalus guentheri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATCTAGTATTTGGTGCCTGAGCCGGAATAGTGGGAACGGCCCTGAGCCTCCTTATTCGGGCAGAGCTAAGCCAACCAGGTGCTCTCCTGGGGGACGACCAGATTTATAATGTAATCGTCACGGCCCACGCGTTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGTGGCTTCGGAAACTGATTGATTCCCCTAATAATCGGGGCGCCTGATATGGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTTCTCCCCCCTTCCTTCTTACTTCTCCTTGCCTCCTCTGGTGTCGAGGCCGGGGCCGGAACAGGTTGGACCGTATATCCTCCGCTAGCGGGCAATCTCGCCCATGCCGGAGCATCCGTTGATCTGACCATCTTCTCCCTACATCTTGCAGGTGTCTCCTCAATCCTCGGGGCCATTAACTTTATCACCACAATCATTAACATAAAACCTCCCGCCATCTCCCAGTACCAAACCCCTCTGTTTGTGTGGGCCGTCCTAATCACTGCCGTTCTTCTTCTTCTCTCCCTCCCTGTTCTTGCAGCGGGCATCACCATGCTTCTCACAGACCGCAATTTAAATACTACTTTCTTCGACCCGGCCGGAGGTGGAGACCCAATCCTCTATCAGCACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lagocephalus guentheri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!