Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found on coral, rubble, or rock bottoms of reef flats (Ref. 9710); also in coastal to outer reef habitats in sheltered lagoons and in caves, sometimes in small aggregations. Usually shallow, from 3-60m (Ref. 30874) but also reported to 80 m depth. Pelagic stages travel great distances and expatriate to sub-tropical zones (Ref. 48635). Spawned in captivity (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East and South Africa, Madagascar and Mascarenes east to Marshall Islands, Samoa and Tonga, north to southern Japan and Ogasawara Islands, south to Shark Bay (Western Australia), Lord Howe and Norfolk islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea and East Africa to Samoa, north to southern Japan and the Ogasawara Islands, south to Australia and Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 6 - 7
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm SL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body reddish with 5 dark bars, alternating with thin dark bars in large specimens; median fins with small dark spots; dark spot on cheek (Ref. 4313). Mid-dorsal spines longer than body depth (Ref. 37816).Description: Characterized by presence of dark band passing through eye; alternating light and dark bands on dorsal spines; deeply incised membranes of spinous portion of dorsal fin; longest dorsal spine equal to or greater than body depth; enlarged and wing-like pectoral fins with rays fully connected by membranes except deeply incised between lower 7-8 unbranched rays; above each eye with slender tentacle; depth of body about 2.7 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Common in the Philippines where it is exported for the aquarium trade; rare in Micronesia. Inhabits shallow reef areas.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body reddish with 5 dark bars, alternating with thin dark bars in large specimens; median fins with small dark spots; dark spot on cheek (Ref. 4313). Mid-dorsal spines longer than body depth (Ref. 37816).Description: Characterized by presence of dark band passing through eye; alternating light and dark bands on dorsal spines; deeply incised membranes of spinous portion of dorsal fin; longest dorsal spine equal to or greater than body depth; enlarged and wing-like pectoral fins with rays fully connected by membranes except deeply incised between lower 7-8 unbranched rays; above each eye with slender tentacle; depth of body about 2.7 in SL (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 90 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0.305 - 150
  Temperature range (°C): 23.446 - 28.954
  Nitrate (umol/L): 0.016 - 3.963
  Salinity (PPS): 32.279 - 35.470
  Oxygen (ml/l): 3.774 - 4.757
  Phosphate (umol/l): 0.113 - 0.491
  Silicate (umol/l): 1.027 - 7.946

Graphical representation

Depth range (m): 0.305 - 150

Temperature range (°C): 23.446 - 28.954

Nitrate (umol/L): 0.016 - 3.963

Salinity (PPS): 32.279 - 35.470

Oxygen (ml/l): 3.774 - 4.757

Phosphate (umol/l): 0.113 - 0.491

Silicate (umol/l): 1.027 - 7.946
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 3 - 15m.
From 3 to 15 meters.

Habitat: reef-associated. Zebra turkeyfish.  (Cuvier, 1829) Attains 20 cm. Body reddish with about 5 dark bars, alternating with thin dark bars in larger specimens. Median fins with small dark spots. Long banded tentacle usually present above the eye. Dark spot on cheek. Usually in shallow water. Off Durban in South Africa at about 50m. And northwards to Red Sea and east to Central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 3 - 80 m (Ref. 30874), usually ? - 60 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 90 specimens in 1 taxon.
Water temperature and chemistry ranges based on 51 samples.

Environmental ranges
  Depth range (m): 0.305 - 150
  Temperature range (°C): 23.446 - 28.954
  Nitrate (umol/L): 0.016 - 3.963
  Salinity (PPS): 32.279 - 35.470
  Oxygen (ml/l): 3.774 - 4.757
  Phosphate (umol/l): 0.113 - 0.491
  Silicate (umol/l): 1.027 - 7.946

Graphical representation

Depth range (m): 0.305 - 150

Temperature range (°C): 23.446 - 28.954

Nitrate (umol/L): 0.016 - 3.963

Salinity (PPS): 32.279 - 35.470

Oxygen (ml/l): 3.774 - 4.757

Phosphate (umol/l): 0.113 - 0.491

Silicate (umol/l): 1.027 - 7.946
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawn in pairs. Courtship and spawning occur at night. Males aggressive, females are smaller and develop almost white face when in courtship. Spawning occurs at the apex of a short and rapid paired ascent resulting in a gelatinous mass of 2,000 to 15,000 eggs. Hatching occurs 36 hours later and larvae settle out in a few weeks at a size of 10-12 mm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrochirus zebra

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGTACAGCCTTGAGCCTACTTATTCGAGCAGAACTTAGTCAACCAGGCGCCCTGTTAGGGGACGACCAAATCTATAATGTAATTGTTACAGCTCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTTATCCCATTAATGATTGGAGCACCCGACATGGCATTTCCTCGTATGAATAACATAAGCTTTTGACTTCTCCCACCCTCTTTCCTGCTTCTTCTAGCCTCTTCCGGAGTTGAGGCTGGAGCTGGGACAGGTTGAACAGTTTACCCGCCCTTAGCCGGTAATCTTGCCCACGCAGGAGCATCCGTAGACTTGACAATTTTCTCCTTACACTTAGCCGGTATCTCGTCAATTCTTGGGGCCATCAACTTTATTACAACGATTATTAACATAAAACCCCCAGCAATCTCTCAGTACCAAACTCCTCTATTCGTATGGGCTGTCTTAATTACGGCAGTTCTTCTGCTTCTTTCACTACCCGTCCTTGCCGCTGGCATTACAATATTACTTACTGATCGAAATCTCAATACCACCTTCTTCGACCCGGCAGGAGGAGGGGACCCAATTCTTTACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendrochirus zebra

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dendrochirus zebra

Dendrochirus zebra, known commonly as the Zebra turkeyfish or Zebra lionfish among other vernacular names, is a species of marine fish in the family Scorpaenidae.

Zebra turkeyfishes are widespread throughout the tropical waters of the Indo-West Pacific including the Red Sea.


Description[edit]

The zebra turkeyfish is an unusual looking fish with vertical stripes in orange, white and black on the body, and large, banded fan-like pectoral fins that flare out on either side as the fish lies on the seabed. The front dorsal fin is made up of thirteen tall, quill-like spines and the second dorsal fin has ten to eleven soft rays. The anal fin has three spines and about ten soft rays. The second dorsal fin, the anal fin and the rounded caudal fin are transversely banded in black and white. This fish grows to a maximum length of about 25 cm (10 in).[1]

Dendrochirus zebra

Distribution and habitat[edit]

The zebra turkeyfish is native to the Indo-Pacific region from the Red Sea to Indonesia and eastern Australia. It is found in inshore waters down to a depth of about 80 m (262 ft). It is a bottom-dwelling species and is found on coral, pebble, and rock bottoms on reef flats, outer reefs and lagoons and also in caves, sometimes in small groups.[1]

Biology[edit]

This member of the scorpion fish family has thirteen venomous spines along its back, used to defend itself. These spines are connected with a clear film-like membrane. These fish are slow-moving and peaceful, but can be dangerous. They have a habit of resting in places hidden from light such as under a rock or a piece of coral.[2] All lionfish are immune to each other's venom and all are solitary fish. Despite their obvious advantage, zebra lionfish feed only on small crustaceans, and are in turn preyed upon by groupers.

Dendrochirus zebra

It reaches a maximum 24 cm and inhabits tropical waters.

References[edit]

  1. ^ a b "Dendrochirus zebra (Cuvier, 1829): Zebra turkeyfish". FishBase. Retrieved 2013-12-19. 
  2. ^ Lieske, E. and R. Myers, 1994. Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!