Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Fairly common inhabitant of reef flats where it is usually encountered in shallow tidal pools. Feeds on crustaceans, small fishes and octopi (Ref. 89972). Often in shipwrecks; usually in pairs or small aggregations, and shares habitat with other morays (Ref. 48635). Also common in sheltered reefs (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Fairly common inhabitant of reef flats where it is usually encountered in shallow tidal pools. Often in shipwrecks; usually in pairs or small aggregations, and shares habitat with other morays (Ref. 48635). Also common in sheltered reefs (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Christmas Island to French Polynesia, north to the Ryukyu Islands and south to Tonga; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Vertebrae: 125 - 137
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

66.0 cm TL (male/unsexed; (Ref. 90102))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Vomerine teeth are biserial and diverging anteriorly with the posterior most 3 to 4 teeth forming a single row (Ref. 37816).Description: Characterized by whitish or pale yellow color; densely mottled with small brown spots; purplish grey color front half of head; white iris; body depth at gill opening17-22 in TL; origin of dorsal fin about midway between gill opening and mouth corner; anus well anterior to middle of body; preanal length about 2.5 in TL; conical teeth, none as canines, in two rows on side of upper jaw and front of lower jaw; median row of intermaxillary with two conical teeth (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vomerine teeth are biserial and diverging anteriorly with the posterior most 3 to 4 teeth forming a single row (Ref. 37816).Description: Characterized by whitish or pale yellow color; densely mottled with small brown spots; purplish grey color front half of head; white iris; body depth at gill opening17-22 in TL; origin of dorsal fin about midway between gill opening and mouth corner; anus well anterior to middle of body; preanal length about 2.5 in TL; conical teeth, none as canines, in two rows on side of upper jaw and front of lower jaw; median row of intermaxillary with two conical teeth (Ref 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 1 - 40
  Temperature range (°C): 22.496 - 29.171
  Nitrate (umol/L): 0.045 - 0.365
  Salinity (PPS): 32.200 - 35.552
  Oxygen (ml/l): 4.427 - 5.079
  Phosphate (umol/l): 0.111 - 0.339
  Silicate (umol/l): 0.910 - 4.465

Graphical representation

Depth range (m): 1 - 40

Temperature range (°C): 22.496 - 29.171

Nitrate (umol/L): 0.045 - 0.365

Salinity (PPS): 32.200 - 35.552

Oxygen (ml/l): 4.427 - 5.079

Phosphate (umol/l): 0.111 - 0.339

Silicate (umol/l): 0.910 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 15 m (Ref. 90102), usually 0 - 4 m (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 38 samples.

Environmental ranges
  Depth range (m): 1 - 40
  Temperature range (°C): 22.496 - 29.171
  Nitrate (umol/L): 0.045 - 0.365
  Salinity (PPS): 32.200 - 35.552
  Oxygen (ml/l): 4.427 - 5.079
  Phosphate (umol/l): 0.111 - 0.339
  Silicate (umol/l): 0.910 - 4.465

Graphical representation

Depth range (m): 1 - 40

Temperature range (°C): 22.496 - 29.171

Nitrate (umol/L): 0.045 - 0.365

Salinity (PPS): 32.200 - 35.552

Oxygen (ml/l): 4.427 - 5.079

Phosphate (umol/l): 0.111 - 0.339

Silicate (umol/l): 0.910 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Often found in coral reefs. A carnivore that feeds on fish and crabs (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Simultaneous hermaphroditism not confirmed (Ref. 84746).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gymnothorax thyrsoideus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACCTAGTATTTGGTGCCTGAGCGGGCATAGTCGGCACTGCTCTAAGCTTACTTATCCGTGCTGAGCTTAGCCAGCCTGGGGCACTCCTCGGAGACGACCAGATCTACAACGTTATCGTAACAGCTCATGCCTTTGTAATAATTTTCTTTATAGTAATACCCGTAATAATTGGGGGCTTTGGAAACTGACTAATCCCGCTAATAATTGGCGCCCCAGATATAGCCTTTCCCCGAATAAATAACATAAGCTTTTGACTGCTTCCCCCATCTTTCCTACTTCTACTGGCCTCCTCTGGAGTAGAGGCAGGGGCCGGCACTGGATGAACCGTATATCCCCCTCTCGCAGGTAATCTAGCCCACGCCGGAGCGTCTGTCGACTTAACCATTTTTTCCCTCCACCTAGCAGGGGTCTCATCAATTTTAGGAGCAATTAATTTCATTACAACCATCATTAATATGAAGCCACCTGCTATTACACAGTATCAAACCCCATTATTTGTATGAGCAGTTCTAGTTACGGCAGTTCTTCTCCTACTATCCCTCCCCGTGCTAGCGGCTGGTATTACGATACTGGTCACTGATCGAAACCTTAACACAACAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gymnothorax thyrsoideus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greyface moray eel

The greyface moray, freckled moray, slender moray, or white-eyed moray,[1] Gymnothorax thyrsoideus, is a species of marine fish in the family Muraenidae.

Description[edit]

The greyface moray is a medium-sized fish that can reach a maximum length of 66 cm, but the ones usually observed are rather 40 cm.[2][3] Its serpentine in shape body has a brown yellowish background color with variation of intensity from a moray to another and it is speckled with a lot of small dark spots. The head is grey to brownish with distinctive white eyes.

Distribution & habitat[edit]

The greyface moray is widespread trough out the Indo-Pacific area from India and Maldives to Polynesia and from south Japan to Australia and New Caledonia.[4]

This moray likes shallow and somewhat turbid waters from lagoons, protected reefs, areas rich in debris and wrecks from the surface to 35 meters deep.[5]

Biology[edit]

The greyface moray is a carnivore and benthic fish. At day, it sits in a shelter often along with other morays and when night came it leaves its lair and actively hunt prey, consisting of small fish and crustaceans.

References[edit]

  1. ^ Common names for Gymnothorax thyrsoideus at www.fishbase.org.
  2. ^ Allen, G.R. and M.V. Erdmann, 2012. Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research.
  3. ^ Randall, J.E., G.R. Allen and R.C. Steene, 1990. Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p.
  4. ^ Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p.
  5. ^ Allen, G.R. and M.V. Erdmann, 2012. Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!